Design of tagging constructs - S. pombe

General design

The tagging constructs used in this study are plasmids. Sequences flanking target genes were PCR-amplified from genomic DNA and cloned into a vector carrying drug resistance markers for E. coli and S. pombe. The flanking sequences distal ends were ligated to each other and the proximal ends were ligated to the vector. Resulting plasmids were amplified in bacteria and linearised at the flanking sequences' junction. Thus a tagging cassette carrying two drug resistance markers, a whole plasmid backbone and two homology regions to the target gene is created.

The major benefit of tagging cassettes of this design is the high efficiency of homologous integration. The reasons for this might be the length of homology regions (200-800 bp) and the clonal origin of transforming DNA.

The complete gene tagging protocol was optimised for speed and reliability.

In silico primer design

The Genedb Pombe dataset as of 25.11.08 was obtained and used for further analysis (chromosome1.contig, chromosome2.contig, chromosome3.contig, mating_type_region.contig, pMIT.contig). We would like to thank Martin Aslett and Valerie Wood from the Sanger Institute for providing GeneDB data and support.

The 25.11.2008 release of Genedb contains 5022 protein coding genes, including mating type locus and mitochondrial genes (sysID2product.txt). For all genes the stop codon was determined based on the GeneDB contig files as above. For two genes (SPMIT.11 and SPAC212.11) no primer prediction was attempted. For the remaining 5020 protein coding genes primer prediction was performed using primer3 (v1.1.3).

While some primer conditions were kept fixed during primer generation (PRIMER_MAX_MISPRIMING=12.00; PRIMER_PAIR_MAX_MISPRIMING=24.00; PRIMER_MAX_TEMPLATE_MISPRIMING=12.00; PRIMER_PAIR_MAX_TEMPLATE_MISPRIMING=24.00; PRIMER_MIN_TM=40.0; PRIMER_OPT_TM=60.0; PRIMER_MAX_TM=75.0; PRIMER_MAX_DIFF_TM=7.5; PRIMER_OPT_GC_PERCENT=50.0; PRIMER_GC_CLAMP=0; PRIMER_SALT_CONC=50.0; PRIMER_DNA_CONC=50.0; PRIMER_MAX_END_STABILITY=9.0) other conditions were varied. Settings for primersize, primer-GC content, primer-self end complementarity, primer-self any complementarity, and primer mono-nucleotide repeats were successively relaxed if no primers were found with the default settings for these parameters (PRIMER_MIN_GC=30, PRIMER_MAX_GC=70, PRIMER_SELF_ANY=8.00, PRIMER_SELF_END=3.00, PRIMER_MAX_POLY_X=6). To reflect such more relaxed conditions notification is provided for primers with a GC outside of the range 30-70%, Tm outside of the range 45-75C, primer end complementarity above 3.0, primer any complementarity above 8.0, mono-nucleotide repeats longer than 5. For 121 genes no primer were suggested for relaxed conditions.

For the 4901 genes for which a upout/upin and dwout/dwin combinations could be suggested the length of the homology region varies from 219 to 556 bp for the upout/upin primer combination (90% of the upout/upin PCR products are 222 to 296 bp in length) and 306 to 782 bp for dwout/dwin combinations (90% of the upout/upin PCR products are 317 to 443 bp in length). All suggested upin primers are located next to the stop codon of the target gene. For most dwin primers the same rule was applied, while in 239 cases the dwin primer was chosen further downstream but in close proximity to the stop codon. The upout/upin and dwout/dwin PCR products of each individual gene are chosen to differ in size, with the dwout/dwin product always being bigger in size (90 % of size differences range between 73 and 174 bp in length).

Cloning and tagging strategy outline

The target gene's flanking regions upstream of the start codon and downstream of the stop codon are designated "up" and "dw", respectively.

PCR primers are picked in silico so that 200 to 800 bp of up and dw regions can be amplified. The primers distal to the target gene ("upout" and "dwout") contain 5'-tails encoding a restriction site for the same enzyme "Enz1". The proximal primers ("upin" and "dwin") contain 5'-tails enconding restrictions site for two different enzymes, "EnzA" and "EnzB".

The PCR products are mixed and purified using a column. T4 ligase is added and amplified homology regions are ligated. Of all possible ligation products, the desired ones are heterodimers of the two homology regions in inverted orientation. After incubation, the DNA is purified using a column. The ligation products are incubated with enzymes EnzA and EnzB to create sticky ends for ligation into the vector and to resolve potential multimers that were created during the ligation into dimers.

The reaction is run on an agarose gel. Because PCR primers are picked so that up and dw regions are of unequal size, usually five bands should be seen. These correspond to (from lower to higher weight) the smaller monomer, the larger monomer, the homodimer of the smaller monomer, the desired heterodimer and the homodimer of the larger monomer. The heterodimer band is excised from the gel and DNA is extracted using a column. The purified heterodimer is ligated to a vector cut with enzymes EnzA and EnzB and bacteria are transformed.

Transformant colonies are checked for integration of the correct target by colony PCR using two primers "upch-uni" and "dwch-uni" (see below). After preparation of the plasmid from bacteria, it is digested with enzyme Enz1, the same enyzme that was used to ligate the two monomers together. The linearised plasmid is transformed into yeast (S. pombe) cells which are plated out on selective medium.

After yeast colonies are formed, clones are checked for correct integration of the tagging construct by PCR using two primers specific for the target gene ("upch" and "dwch") and two primers specific for the plasmid ("upch-uni" and "dwch-uni"). Two PCR reactions test for correct integration in up and dw regions.

Materials used

For tagging of one gene:

  • Oligonucleotides, standard synthesis, desalted.
  • 460 µl PCR reactions, 8.5 µl restriction enzymes, 4 µl T4 ligase, four DNA purification columns
  • Competent bacteria and yeast cells and facilities for transforming and culturing them.

Gene tagging protocol

PCR reactions were set up using a commercial PCR kit from Fermentas. Reagents from any other supplier should also work. Restriction enzymes were supplied by Fermentas or Roche. Universal checking primers: For checking of bacterial inserts two primers are required: upch-uni located approximately 140 bp upstream of the MCS and dwch-uni located approximately 40 bp downstream of the MCS. For checking of yeast transformants the same primers are used:

  • upch-uni "gaagcagtggtcttcaactcg"
  • dwch-uni "tgtcggggctggcttaacta"
pTAPKan1 is the vector used for cloning tagging constructs. It contains the kanMX6 maker gene, conferring resistance to Geneticin (G418). It was constructed by digestion with NdeI and PacI of pFA6a-TAP-KanMx6 (Kim Nasmyth plasmid collection number 4110) and ligation of two annealed oligonucleotides coding for new restriction sites:
  • TAP_MCSfw aattcatatgatcaccggtaccctaggatccagcgctagcgctgtcgacggtcttaaggcgcccgggttaattaaaatt
  • TAP_MCSrv aattttaattaacccgggcgccttaagaccgtcgacagcgctagcgctggatcctagggtaccggtgatcatatgaatt
The resulting MCS contains the following restriction sites: NdeI - KpnI - BamHI - NheI - SalI - AflII - XmaI - PacI plus other rare ones.
Per ligation you need 10 ng of vector digested with two restriction enzymes and dephosphorylated. It is advisable to prepare the vector very well: Digest it with restriction enzyme, electrophorese it on an agarose gel until the bromphenol blue dye has migrated at least 10 cm, extract it and dephosphorylate it with shrimp alkaline phosphatase.
Bacteria and media:
We used DH5alpha cells made competent using the CaCl2 method and LB medium containing 100 µg/l ampicillin. Other bacterial strains suitable for standard cloning should work just as well. Yeast cells and media: We used S. pombe cells made competent using Li-acetate. Cells was cultured at 32°C in standard YES medium supplemented with 0.15g/l adenine and 0.1g/l uracil, L-histidine, L-lysine and L-leucine. For selection, Geneticin was added at 100 µg/ml. Genomic DNA of S. pombe from which to amplify the homology regions. For DNA purification from PCR, restriction digest or agarose gel we used anion exchange columns from Qiagen. Products of any other supplier should work just as well.